Tune in. Never miss
an important update!
Your Name
Your Email
Lipoma Board

An Ongoing Search For Lipoma Treatment And Lipoma Cure

What is Lipoma Board? A forum and community offering information, alternative treatments, resources and support concerning lipomas, lipomatosis and other related conditions. Surgery shouldn't be the only option! Lipomas are fatty tumors under the skin. Read more >>

All times are UTC [ DST ]

Triphala



Post new topic Reply to topic  [ 8 posts ] 
  Print view | E-mail friend

 home treatments? lemon juice? limit zinc?
Author Message
PostPosted: 7/5/11 Tuesday, 11:09 pm 
Regular
Offline

Joined:Sat Jun 11, 2011 11:15 pm
Posts:92
stumbled upon a website saying that:

Lemon Juice

*


Consider adding lemon juice to the water that you drink. Lemon juice works to eliminate toxins from the body by stimulating and strengthening the digestive system and purifying the liver. Because of its toxin-eliminating properties, lemon water will help prevent and even treat fatty tumors, or lipoma.

there are more on the website: anyone tried lemon juice? might just have to by some and try=P

http://www.ehow.com/way_5255826_herbal- ... ipoma.html



Last edited by matt on Tue Aug 30, 2011 3:53 pm, edited 2 times in total.
Added zinc to the subject.


Report this post
Top
 Profile Send private message  
Reply with quote  

 Re: home treatments? lemon juice?
PostPosted: 8/30/11 Tuesday, 11:45 am 
I currently drink lemon juice now. The lipomas have definitely slowed down since the initial onslaught; however, they have not stopped. I can't say for certain why they came on so fast, but here's what I know: I found out that my liver levels were high when the growth of lipomas were at its peak (finally figured out that it was due to a medication). I was also taking a lot of zinc supplements at the time, and I read somewhere that zinc can accelerate the growth of lipomas.

Also, Matt had mentioned something about fungus being related to lipoma growth. I'm wondering if this is true. In fact, the first lipoma I ever got (at age 24) was at the same time I first got athlete's foot. I actually went to the doctor about the athlete's foot, and asked him what the thing growing in my tricep was.

Fast forward 4 and 1/2 years, I am battling athlete's foot again on and off (granted my liver levels are high at this point and I'm taking a lot of zinc) and lipomas are forming like nobody's business (didn't have any lipomas form in between). Eventually I end up getting some toenail fungus (how much more attractive can I get?) and I am still currently trying to fight it off. Additionally, I am just getting rid of some ringworm that I contracted from the mats where I train (mixed martial arts). Furthermore, about a year ago, my wife went to a nutritionist and had some tests due for stomach pains doctors couldn't explain, which came back showing candida. And if I think back, the multiple growths of lipomas didn't start until about 4 or 5 months after dating her. Perhaps I picked something up from her?

And in researching ways to treat my issues with my feet, I've read that a systemic fungal infection can be the cause.

Now, this could all be coincidence. After all, I've lived in gyms my whole life. Many people have had fungal issues without lipomas, but perhaps it just affects people differently based on their genetic makeup. There are also many people who smoke who never develop lung cancer. Just because there are and/or have been cancer-free smokers, that doesn't mean smoking isn't a catalyst for cancer. So, perhaps fungus is a catalyst for lipomas in some people? I'm sure as heck not a doctor, but these are just my thoughts and observations.

I keep praying for a cure though, or at least better treatment options...


Report this post
Top
  
Reply with quote  

 Re: home treatments? lemon juice?
PostPosted: 8/30/11 Tuesday, 2:39 pm 
Master Member
User avatar
Offline

Joined:Tue Mar 29, 2011 8:01 am
Posts:982
Location: Finland
Number of lipomas: 61-100
ryan, I feel you! I have had multiple mysterious conditions the lipomatosis now being the worse atm. Maybe I did somthing bad in my previous life or something? :cry: But anyways, there was a long post about zinc in the old lipomaforum telling you should limit zinc intake. The guy sounds quite convincing with all his chromosome and gene talk:

Quote:
A few years ago I had a really bad cold and sore throat and lived off zinc lozenges for a month. I developed several new lipomas which formed alarmingly rapidly the next month. I’m a molecular geneticist so I set out to find out why. The take home message is to limit your zinc intake…and I have a lot of science which backs this up! Here goes…..
The gene encoding the transcription factor HMGA2 (HMGI-C) on chromosome 12q15 is the most frequently rearranged gene in lipomas. The Lipoma Preferred translocation Partner (LPP) gene on chromosome 3q27-28 is the most frequent translocation partner of HMGA2. LPP (LIM-containing Lipoma Preferred translocation Partner) contains a zinc-finger LIM domain. Zinc-finger domains are regions or domains of proteins which bind free zinc ions and then allow the protein to bind DNA and regulate the transcription or expression of other genes. The binding of the zinc ions is essential for the proper function of the LPP protein. The chromosome break/fusion event between HMGA2 with LPP results in a fusion protein called HMGA2/LPP. LPP is normally localized in the cell at sites of cell adhesion and only transiently in the nucleus. However, the fusion of HMGA2 with LPP permanently localizes LPP to the nucleus. In these lipomas, HMGA2/LPP fusion transcripts are expressed, which encode for the three AT-hooks of HMGA2 followed by the two most carboxyl-terminal LIM domains (protein-protein interaction domains) of LPP. Previous studies revealed that the LIM domains of LPP have transcriptional activation capacity i.e., they function to turn on the expression of other genes. A recent paper just showed that the HMGA2/LPP fusion protein retains the transactivation functions of the LPP LIM domains and thus functions as a transcription factor. (Crombez KR et al., 2005 Transactivation functions of the tumor-specific HMGA2/LPP fusion protein are augmented by wild-type HMGA2.Mol Cancer Res. 2005 Feb;3(2):63-70. PMID: 15755872). Hence the LIM domains (which bind zinc) are essential for the transcriptional activity of the HMGA2/LPP protein. Thus, without adequate zinc, the protein won’t be able to activate other genes responsible for producing fatty tumors.
There are dozens of scientific publications which show that many lipomas result from a translocation (chromosome break and fusion event) involving HMGA2. Chromosome segment 12q13-->q15 recombines with many different chromosome bands in lipomas and at least ten recurrent translocations have been identified. The HMGA2 gene is almost always rearranged. Fusion genes between HMGA2 (12q14-->q15) and LPP (3q27-->q28), LHFP (13q12) and CMKOR1 (2q37) have been reported. In a very recent study, eight lipomas with rearrangements involving chromosome bands 12q14-->q15 and 5q32-->q33 were analyzed. In chromosome 5, five of the cases had a breakpoint in the 5' part of EBF in 5q33, while three cases had breakpoints located about 200 kb 3' of EBF. In chromosome 12, the breakpoints clustered to the region of HMGA2. Many of the HMGA2/EBF transcript, were out of frame and resulted in truncation of EBF. The combined data indicate that the pathogenetically significant event is fusion, truncation or transcriptional activation of HMGA2, (Nilsson et al., 2006 Truncation and fusion of HMGA2 in lipomas with rearrangements of 5q32-->q33 and 12q14-->q15.Cytogenet Genome Res. 2006;112(1-2):60-6. PMID: 16276091).
Thus it appears that if we are able to inhibit the transcriptional activation of HMGA2 (HMG1-C) then we could prevent the formation of lipomas.

In order to see how a gene is regulated there are a number of bioinformatics tools available (sorry for the molecular lingo for non genetics experts out there). Here’s a sample of some of the analyses I did. I took the genetic sequence of the HMGA2 gene and analyzed it. A genomic scan of the promoter of the human HMGA2 gene (http://bimas.dcrt.nih.gov/molbio/proscan/) revealed a high scoring predictive metal response element “tgcgcccgg” about 4 kilobases upstream of the HMGA2 predicted +1 transcription start site (cacaccacacacactcacactca….). Metal response elements are nucleotide sequences which are bound by zinc in order to activate transcription or production of the HMGA2 in your body. Also of note, promoter scans of the HMGA2 gene also predict that this gene is regulated by the Sp1 zinc-finger transcription factor (although many genes are regulated by this protein). Thus zinc seems to regulate the transcription of this gene. Hence, once again, this suggests that limiting your zinc intake might prevent lipoma formation.

There is also some evidence that zinc may cause lipomas from HIV patient data. AIDS patients are known to suffer from reduced zinc bioavailability, more severe in stage IV than in stage III. These results suggested that zinc dietary supplementation should be used to reduce AZT-induced bone marrow toxicity.( PubMed ID: 8876661). So many physicians prescribed zinc to their HIV patients….the result is that many HIV patients receiving AZT get lipomas.
Also of interest is another HIV study which showed that Efavirenz and indinavir, two Highly Active Retroviral Therapies (HAART) caused an increase in Multiple Lipomas . Many of these HIV protease inhibitors are zinc finger protein inhibitors which result in an increased bioavailability of zinc. Zinc-finger proteins normally bind free zinc ions to become catalytically active – hence, if they are inhibited, there is more zinc floating around in your body to bind other promoters or other zinc fingers domains. Free biovailable Zinc levels have been shown to be reduced in the blood of HIV infected patients hence more is likely bound to zinc proteins. (Biol Trace Elem Res. 1995 Jan-Mar;47(1-3):133-8.).

There are numerous scientific papers which highlight the role of dietary zinc in controlling the body’s fatty acid or cholesterol levels. I’ll just quote the PubMed IDs of the papers to make it easier (you can search for the details of any of these papers at : http://www.ncbi.nlm.nih.gov/entrez/quer ... pubmed&cmd
There is a significant positive correlation between serum zinc levels and the levels of cholesterol, LDL-C, and Apo B.( PMID: 14993866).
Serum-Zn has also been positively correlated to total cholesterol, HDL-cholesterol , and LDL-cholesterol (PMID: 2607070).
It has been shown that high doses (160 mg) of zinc lower your good cholesterol i.e., HDL-C (high-density lipoprotein-cholesterol)(PMID: 6748177).
Zn2+ has also been shown to inhibit lipolysis or fat-breakdown (PMID: 6279634). Specifically, in rat adipocytes, its been shown that concentrations of Zn2+ between 250 and 1000 microMolar stimulated glucose metabolism into glyceride-fatty acid.
According to another Pubmed article (PMID: 240709), using zinc supplements of amounts well in excess of the Recommended Dietary Allowance (RDA) (100-300 mg Zn/day verses an RDA of 15 mg Zn/day), resulted in induced copper deficiency with symptoms of impaired immune function and adverse effects on the ratio of low-density-lipoprotein to high-density-lipoprotein (LDL/HDL) cholesterol. Even lower levels of zinc supplementation, closer in amount to the RDA, have been suggested to interfere with the utilization of copper and iron and to adversely affect HDL cholesterol concentrations. In conclusion, they say that individuals using zinc supplements should be aware of the possible complications attendant to their use. (PMID: 2407097).
The mineral zinc is also found in some dandruff shampoos and helps regulate the activity of your oil glands…again fat regulation.


So how do you decrease (not eliminate) the zinc in your diet? Here goes.....
Zinc-rich foods link: http://ods.od.nih.gov/factsheets/cc/zinc.html

Zinc is found in high concentrations in both the testes and the prostate gland, and a zinc deficiency can reduce testosterone levels and sperm count. Supplementing with this mineral may be particularly important for vegetarians because zinc is found in highest quantities in animal products.

Zinc is also vital for immunity, growth and development, and prostate health.

Food sources include pumpkin seeds, oysters, mushrooms, dairy products, whole grain cereals, and beef, and eggs. The egg yolk contains all the fat and all the zinc…so egg whites are a good one!

The Recommended Daily Intake (RDI) for zinc is 15 mg for adult men.


How to decrease your zinc absorption:

Alcohol has been shown to decrease the absorption of zinc and increases loss of zinc in urine. However, some chronic alcoholics have reportedly shown an increase in lipomas…..so a glass or so a day is recommended.

Iron and calcium supplements appear to inhibit or decrease zinc absorption: Women who take large amounts of calcium (more than 1,400 milligrams a day) have been shown to have lower zinc absorption. Prunes contain a lot of copper which may help to decrease zinc.

Foods high in fiber, which contain phytic acid, such as unrefined wholegrain cereals, bran, nuts and unleavened bread, can decrease zinc absorption. Phytic acid forms a highly insoluble complex with zinc which the body cannot absorb. Soybeans and Soya products are high in phytic acid, i.e., it is present in the bran or hulls of all seeds. Phytic acid is a substance that can block the uptake of essential minerals - calcium, magnesium, copper, iron and especially zinc - in the intestinal tract. Although not a household word, phytic acid has been extensively studied; there are literally hundreds of articles on the effects of phytic acid in the current scientific literature. (Crit Rev Food Sci Nutr. 1995 Nov;35(6):495-508.)
Phytic acid, a major phosphorus storage compound of most seeds and cereal grains, contributes about 1 to 7% of their dry weight. It may account for more than 70% of the total kernel phosphorus. Phytic acid has the strong ability to chelate multivalent metal ions, especially zinc, calcium, and iron. The binding can result in very insoluble salts that are poorly absorbed from the gastrointestinal tract, which results in poor bioavailability of minerals. Alternatively, the ability of Phytic acid to chelate minerals has been reported to have some protective effects, such as lowering serum cholesterol and triglycerides in experimental animals. Phytic acid is also considered to be a natural antioxidant and is suggested to have potential functions of reducing lipid peroxidation and as a preservative in foods. Finally, certain inositol phosphates, which may be derived from Phytic acid, have been noted to have a function in second messenger transduction systems. The potential nutritional significance of Phtic acid is discussed in this review. PMID: 8777015 [PubMed].
Thus, I would recommend that if you take a daily multi-vitamin be sure it DOES NOT contain any zinc. You obviously need some zinc in your diet since its an essential nutrient. Have a glass of alcohol each day, and eat plenty of unrefined whole grained cereals (brans, nuts), prunes, phytic acid supplement etc.
Unfortunately limiting your zinc intake won’t get rid of your existing lipomas but it should stop or slow the generation of new ones. This has worked for me.


The thread is actually quite interesting, I was able to find it using the WaybackMachine: http://web.archive.org/web/200708070857 ... php?t=2834

BTW I have never had any fungal infections that I have been aware of.

_________________
Matt has dozens of small nasty lipomas all over. Has tried many treatments including surgery and Lipostabil injections. Open to any bit of information. Matt's lipoma prevention supplements. Matt uses Emu oil for scars. Latest test with Triphala.


Report this post
Top
 Profile Send private message  
Reply with quote  

 Re: home treatments? lemon juice? limit zinc?
PostPosted: 8/30/11 Tuesday, 2:55 pm 
Master Member
User avatar
Offline

Joined:Tue Mar 29, 2011 8:01 am
Posts:982
Location: Finland
Number of lipomas: 61-100
That's quite hard to read actually. Too much of little details about microbiology. I need learn myself some more of it so I can read it ;)

_________________
Matt has dozens of small nasty lipomas all over. Has tried many treatments including surgery and Lipostabil injections. Open to any bit of information. Matt's lipoma prevention supplements. Matt uses Emu oil for scars. Latest test with Triphala.


Report this post
Top
 Profile Send private message  
Reply with quote  

 Re: home treatments? lemon juice? limit zinc?
PostPosted: 8/16/12 Thursday, 4:33 pm 
I had a very small lump (rather a few lumps) that were hardly visible. Couple of years back one of them on my arm suddenly increased in size. While reading your message above about limiting intake of Zinc, I just realized that the increase in size happened after i started taking multi vitamin supplements. I just checked the pack and saw it has Zinc (15 mg) in it. Not sure if this has been the cause but I will stop taking the supplements for some time and see if there is any impact. Will keep ya posted.


Report this post
Top
  
Reply with quote  

 Re: home treatments? lemon juice? limit zinc?
PostPosted: 8/24/12 Friday, 3:07 pm 
Regular
Offline

Joined:Sat Aug 04, 2012 9:14 pm
Posts:35
Number of lipomas: 1
Actually I been taking lots and lots of zinc and my lipomas are just about gone. I also take huge amounts of lemon juice.

Last time I went to costco nearly a year ago I bought ten bottles of real lemon. Last week the dollar store had them and I bought 20 bottles. I go through at least one a month. I been taking lemon juice for years. I think it helps reduce them.

A few months ago I started adding 50 mg of ionic zinc to every gallon of water along with a teaspoon of concentrace minerals. I use nearly two gallons of water per day because I drink it and cook with it. At the same time I started taking the Now brand coloidal mineral supplement made from fulvic acid. That was the point I noticed them disappearing rapidly. I also became vegan about the same time.

This is just my opinion and you can do with it what you want but I believe it's the fulvic acid in the colloidal minerals that is responsible for my lipomas dissolving. Including the zinc! The body needs zinc. You can't live without it. I find it hard to believe that it would be causing lipomas but if it does it would be a secondary symptom at best. An analogy might be, all drunk drivers use cars but all cars are not driven by drunk drivers. Reducing the number of cars will reduce the number of drunk drivers but it will also reduce the number of sober ones, causing unintended consequences.

_________________
aka surfstev


Report this post
Top
 Profile Send private message  
Reply with quote  

 Re: home treatments? lemon juice? limit zinc?
PostPosted: 11/26/12 Monday, 9:02 am 
Master Member
Offline

Joined:Mon Mar 12, 2012 7:14 pm
Posts:311
Surfsteve if you think you found a cure since you're saying your lipomas started to go away rapidly. I think it will be much better if you open up a new topic about this and describe your experience in a constructed and detailed manner, thanks for sharing!

_________________
DEAR LIPOMABOARD USERS, PLEASE CREATE YOUR "USER EXPERIENCE" TOPIC HERE SO WE CAN HAVE A CENTRALIZED, EASY TO ANALYZE DATABASE WHICH WILL BENEFIT US ALL: http://www.lipomaboard.com/user-experiences-f13/

THANK YOU.


Report this post
Top
 Profile Send private message  
Reply with quote  

 Re: home treatments? lemon juice? limit zinc?
PostPosted: 4/30/13 Tuesday, 2:36 pm 
Guest
Offline

Joined:Tue Apr 30, 2013 3:17 pm
Posts:7
Number of lipomas: 11-30
Citrus fruits and citrus fruits juices are good to eliminating the toxin in body.
It's a good idea to add the lemon juices or some other citrus fruits juices in diet to reduce the lipomas by reducing the toxin.


Report this post
Top
 Profile Send private message  
Reply with quote  

Display posts from previous:  Sort by  
Post new topic Reply to topic  [ 8 posts ] 

All times are UTC [ DST ]


  Similar topics


  Who is online

Users browsing this forum: No registered users and 2 guests


You can post new topics in this forum
You can reply to topics in this forum
You cannot edit your posts in this forum
You cannot delete your posts in this forum
You cannot post attachments in this forum

Search for:
Jump to:  
injectable collagenase multiple lipoma treatment icd 9 lipoma lipomatous tissue lipoma icd 9 submental lipomatosis what is lipomas what are lipomas lipoma disease lipoma photos lipomas photos what are lipomas definition lipoma multiple symmetric lipomatosis lipoma pain lipoma disease bariena lunulina what is lipoma familial multiple lipomatosis familial lipomatosis benign symmetric lipomatosis familial multiple lipomatosis familial lipomatosis hereditary multiple lipomatosis painful lipoma painful lipomas encapsulated lipoma multiple lipomatosis definition of familial superficial subcutaneous lipoma lipomatosis definition lipoma painful what causes lipoma lipoma treatments multiple lipomatosis lipomatosis definition madelung syndrome collagenase injection lipoma treatment options what is a lipoma benign lipoma benign lipoma pictures what causes lipomas lipoma surgery cost definition of lipoma xiaflex treatment lipomas painful low moral define lipoma lipoma buttock multiple lipoma multiple lipomas lipoma cure